6GH0 | pdb_00006gh0

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the least restraint violations 

wwPDB Validation   3D Report Full Report


This is version 1.4 of the entry. See complete history


Literature

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

Kotar, A.Rigo, R.Sissi, C.Plavec, J.

(2019) Nucleic Acids Res 47: 2641-2653

  • DOI: https://doi.org/10.1093/nar/gky1269
  • Primary Citation of Related Structures:  
    6GH0

  • PubMed Abstract: 

    In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.


  • Organizational Affiliation

    Slovenian NMR Center, National Institute of Chemistry, 1000 Ljubljana, Slovenia.


Macromolecules

Find similar nucleic acids by:  Sequence   |   3D Structure  

Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3')22Homo sapiens
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the least restraint violations 

Structure Validation

View Full Validation Report



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
Slovenian Research AgencySloveniaP1-0242
Slovenian Research AgencySloveniaJ1-6733
ItalyCPDA147272/14

Revision History  (Full details and data files)

  • Version 1.0: 2019-01-09
    Type: Initial release
  • Version 1.1: 2019-03-20
    Changes: Data collection, Database references
  • Version 1.2: 2019-05-08
    Changes: Data collection
  • Version 1.3: 2019-10-30
    Changes: Data collection, Database references
  • Version 1.4: 2024-05-15
    Changes: Data collection, Database references